Review



anti hcn3  (Alomone Labs)


Bioz Verified Symbol Alomone Labs is a verified supplier
Bioz Manufacturer Symbol Alomone Labs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Alomone Labs anti hcn3
    Anti Hcn3, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 37 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti hcn3/product/Alomone Labs
    Average 94 stars, based on 37 article reviews
    anti hcn3 - by Bioz Stars, 2026-02
    94/100 stars

    Images



    Similar Products

    anti hcn3  (Alomone Labs)
    94
    Alomone Labs anti hcn3
    Anti Hcn3, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti hcn3/product/Alomone Labs
    Average 94 stars, based on 1 article reviews
    anti hcn3 - by Bioz Stars, 2026-02
    94/100 stars
    		  Buy from Supplier
    gene exp hcn3 mm01212852 m1  (Thermo Fisher)
    92
    Thermo Fisher gene exp hcn3 mm01212852 m1
    Gene Exp Hcn3 Mm01212852 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp hcn3 mm01212852 m1/product/Thermo Fisher
    Average 92 stars, based on 1 article reviews
    gene exp hcn3 mm01212852 m1 - by Bioz Stars, 2026-02
    92/100 stars
    		  Buy from Supplier
    membrane  (Alomone Labs)
    94
    Alomone Labs membrane
    Membrane, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/membrane/product/Alomone Labs
    Average 94 stars, based on 1 article reviews
    membrane - by Bioz Stars, 2026-02
    94/100 stars
    		  Buy from Supplier
    rabbit anti hcn3  (Alomone Labs)
    94
    Alomone Labs rabbit anti hcn3
    Rabbit Anti Hcn3, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit anti hcn3/product/Alomone Labs
    Average 94 stars, based on 1 article reviews
    rabbit anti hcn3 - by Bioz Stars, 2026-02
    94/100 stars
    		  Buy from Supplier
    rabbit antihcn3  (Alomone Labs)
    94
    Alomone Labs rabbit antihcn3
    Rabbit Antihcn3, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit antihcn3/product/Alomone Labs
    Average 94 stars, based on 1 article reviews
    rabbit antihcn3 - by Bioz Stars, 2026-02
    94/100 stars
    		  Buy from Supplier
    hcn3 primers: 5′‐gttggagaggcccaacgagt‐3′ (forward), 5′‐cgatttccaccgctttgtgg‐3′ (reverse  (Servicebio Inc)
    90
    Servicebio Inc hcn3 primers: 5′‐gttggagaggcccaacgagt‐3′ (forward), 5′‐cgatttccaccgctttgtgg‐3′ (reverse
    Hcn3 Primers: 5′‐Gttggagaggcccaacgagt‐3′ (Forward), 5′‐Cgatttccaccgctttgtgg‐3′ (Reverse, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hcn3 primers: 5′‐gttggagaggcccaacgagt‐3′ (forward), 5′‐cgatttccaccgctttgtgg‐3′ (reverse/product/Servicebio Inc
    Average 90 stars, based on 1 article reviews
    hcn3 primers: 5′‐gttggagaggcccaacgagt‐3′ (forward), 5′‐cgatttccaccgctttgtgg‐3′ (reverse - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    hcn3 primers: 50-gttggagaggcccaacgagt-30 (forward), 50-cgatttccaccgctttgtgg-30 (reverse)  (Servicebio Inc)
    90
    Servicebio Inc hcn3 primers: 50-gttggagaggcccaacgagt-30 (forward), 50-cgatttccaccgctttgtgg-30 (reverse)
    Hcn3 Primers: 50 Gttggagaggcccaacgagt 30 (Forward), 50 Cgatttccaccgctttgtgg 30 (Reverse), supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hcn3 primers: 50-gttggagaggcccaacgagt-30 (forward), 50-cgatttccaccgctttgtgg-30 (reverse)/product/Servicebio Inc
    Average 90 stars, based on 1 article reviews
    hcn3 primers: 50-gttggagaggcccaacgagt-30 (forward), 50-cgatttccaccgctttgtgg-30 (reverse) - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier

    Image Search Results